Journal: Frontiers in pharmacology

Article Title: Salidroside Improves Chronic Stress Induced Depressive Symptoms Through Microglial Activation Suppression.

doi: 10.3389/fphar.2021.635762

Figure Lengend Snippet: FIGURE 2 | SLDS suppressed microglia activation and pro-inflammatory cytokines release in hippocampus of chronic stress exposed mice. (A) Representative images illustrating microglia stained with Iba-1 and CD68 antibodies in hippocampal sections. Scale bar, 100 µm; (B) Number of Iba-1 positive microglia in hippocampal sections [F(2,27) 1.515, P 0.2568]; (C) Number of CD68 positive microglia in hippocampal sections [F(2,27) 151.9, P < 0.0001]; (D) mRNA level of IL-1β [F(2,9) 35.23, P < 0.0001], IL-6 [F(2,9) 19.28, P 0.0006], IL-18 [F(2,9) 9.481, P 0.0061] and TNF-α [F(2,9) 12.61, P 0.0025] in hippocampus determined by qRT- PCR (n 4); (E) The secretion level of IL-1β [F(2,15) 8.063, P 0.0042], IL-6 [F(2,15) 29.19, P < 0.0001], IL-18 [F(2,15) 5.890, P 0.0129] and TNF-α [F(2,15) 24.66, P < 0.0001] in hippocampus determined using ELISA (n 4); (F) P-ERK1/2 [F(2,9) 10.15, P 0.0049] in hippocampal area tissue; (G) P-p38 MAPK [F(2,12) 13.05, P 0.0010] in hippocampal area tissue; (H) P-p65 NF-κB [F(2,15) 28.59, P < 0.0001] in hippocampal area tissue; (I) iNOS expression [F(2,15) 14.42, P 0.0003] in hippocampal area tissue. All data are presented as mean ± SD. * P < 0.05, ** P <0.01, ***P <0.005, compare to control group; # P < 0.05, ## P <0.01, ###P < 0.005, compare to stress group.

Article Snippet: Rabbit polyclonal antibodies against phospho-p42/44 MAPK, p42/ 44 MAPK, phospho-p38 MAPK, p38 MAPK, phospho-NF-κB p65, NF-κB p65, iNOS (1:5000, CST), phospho-paxillin Ser83 and mouse polyclonal antibodies against paxillin (1:2500, ECM biosciences), α-Tubulin (1:10000, CST) were used.

Techniques: Activation Assay, Staining, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Expressing, Control

Journal: Frontiers in pharmacology

Article Title: Salidroside Improves Chronic Stress Induced Depressive Symptoms Through Microglial Activation Suppression.

doi: 10.3389/fphar.2021.635762

Figure Lengend Snippet: FIGURE 3 | SLDS reduced the levels of proinflammatory cytokines and suppressed microglial activation in LPS induced primary microglia. (A) The cell viability with SLDS (0, 50, 100 and 200 μM) alone [F(3,12) 1.524, P 0.2588] in primary microglia; (B) The cell viability with SLDS (0, 50, 100 and 200 μM) and LPS 1 μg/ml [F(4,31) 0.6963, P 0.6003] in primary microglia; (C) mRNA levels of IL-1β [F(2,9) 17.54, P 0.0008], IL-6 [F(2,9) 25.80, P 0.0002], IL-18 [F(2,9) 8.516, P 0.0084] and TNF-α [F(2,9) 81.80, P < 0.0001] in primary microglia (n 4); (D) The secretion levels of IL-1β [F(2,21) 57.51, P < 0.0001], IL-6 [F(2,21) 19.17, P < 0.0001], IL-18 [F(2,21) 21.64, P < 0.0001] and TNF-α [F(2,21) 23.71, P < 0.0001] in primary microglia (n 4); (E) P-ERK1/2 [F(2,15) 72.91, P < 0.0001] in primary microglia; (F) P-p38 MAPK [F(2,12) 17.38, P 0.0003] in primary microglia; (G) P-p65 NF-κB [F(2,9) 86.64, P < 0.0001] in primary microglia; (H) iNOS expression [F(2,11) 12.46, P 0.0015] in primary microglia. All data are presented as mean ± SD. ** P <0.01, ***P <0.005, compare to control group; # P < 0.05 ## P <0.01 ###P < 0.005, compare to LPS treated group.

Article Snippet: Rabbit polyclonal antibodies against phospho-p42/44 MAPK, p42/ 44 MAPK, phospho-p38 MAPK, p38 MAPK, phospho-NF-κB p65, NF-κB p65, iNOS (1:5000, CST), phospho-paxillin Ser83 and mouse polyclonal antibodies against paxillin (1:2500, ECM biosciences), α-Tubulin (1:10000, CST) were used.

Techniques: Activation Assay, Expressing, Control

Journal: Frontiers in pharmacology

Article Title: Salidroside Improves Chronic Stress Induced Depressive Symptoms Through Microglial Activation Suppression.

doi: 10.3389/fphar.2021.635762

Figure Lengend Snippet: FIGURE 6 | Anti-inflammation mechanism of SLDS in LPS induced primary microglia. LPS signal from infections activates microglia through TLRs and further activates ERK1/2, p38 MAPK, NF-κB signaling. Signals translocate to nucleus and induce the transcription of inflammatory cytokines IL-1β, IL-6, IL-18 and TNF-α. On the other hand, cytoskeleton changes generate the mechanical forces that drive cell motility and phagocytosis which are closely associated with microglial function. LPS signals induce the cytoskeleton protein vimentin filaments assembly which leads to the morphological changes from ramified state to ameboid state. Meanwhile, they regulate focal adhesion assembly which results in the cell attachment state alteration. SLDS can inhibit the LPS signals transduction thus blocking the activation of microglia and prevent cytoskeleton changes.

Article Snippet: Rabbit polyclonal antibodies against phospho-p42/44 MAPK, p42/ 44 MAPK, phospho-p38 MAPK, p38 MAPK, phospho-NF-κB p65, NF-κB p65, iNOS (1:5000, CST), phospho-paxillin Ser83 and mouse polyclonal antibodies against paxillin (1:2500, ECM biosciences), α-Tubulin (1:10000, CST) were used.

Techniques: Cell Attachment Assay, Transduction, Blocking Assay, Activation Assay

Journal: PloS one

Article Title: Human Melanoma cells over-express extracellular matrix 1 (ECM1) which is regulated by TFAP2C.

doi: 10.1371/journal.pone.0073953

Figure Lengend Snippet: Figure 2. Regulation of ECM1 expression in WM793B. Upregulation of TFAP2 in WM793B melanoma cells using AdAP2A andAdAP2C leads to increased ECM1 expression compared to mock infected cells and those infected with GFP vector (used as an infection control) as determined by Western blot.

Article Snippet: After blocking was accomplished with 5% milk Tris Buffer Saline Tween-20 solution, the primary antibody was added - TFAP2 (Abcam, Cambridge MA), to the nuclear fraction membrane at 1:15,000 dilution or ECM1 antibody (Santa Cruz Polyclonal anti ECM-1 (N-17), cat No sc-65086), 1:1000 to the cytoplasmic fraction.

Techniques: Expressing, Infection, Plasmid Preparation, Control, Western Blot

Journal: PloS one

Article Title: Human Melanoma cells over-express extracellular matrix 1 (ECM1) which is regulated by TFAP2C.

doi: 10.1371/journal.pone.0073953

Figure Lengend Snippet: Figure 3. Regulation of ECM1 in A375. Blocking of TFAP2C expression using siRNA in A375 cell line leads to reduced ECM1 mRNA by 72 hours (A) and reduced ECM1protein expression by 96 hours (B). Non-targeting (NT) siRNA was used as a transfection control. Samples were run in triplicate and the graph represents the mean results from 2 different experiments. Expression levels are relative to those in mock- treated A375 cells.

Article Snippet: After blocking was accomplished with 5% milk Tris Buffer Saline Tween-20 solution, the primary antibody was added - TFAP2 (Abcam, Cambridge MA), to the nuclear fraction membrane at 1:15,000 dilution or ECM1 antibody (Santa Cruz Polyclonal anti ECM-1 (N-17), cat No sc-65086), 1:1000 to the cytoplasmic fraction.

Techniques: Blocking Assay, Expressing, Transfection, Control

Journal: PloS one

Article Title: Human Melanoma cells over-express extracellular matrix 1 (ECM1) which is regulated by TFAP2C.

doi: 10.1371/journal.pone.0073953

Figure Lengend Snippet: Figure 1. ECM1 expression in melanoma cell lines. Western blots showing expression of TFAP2A, TFAP2C and ECM1 in primary melanocytes (M) and melanoma cell lines (M21, M14 subclone 2C5, WM793 and A375). GAPDH was used as a loading control.

Article Snippet: After blocking was accomplished with 5% milk Tris Buffer Saline Tween-20 solution, the primary antibody was added - TFAP2 (Abcam, Cambridge MA), to the nuclear fraction membrane at 1:15,000 dilution or ECM1 antibody (Santa Cruz Polyclonal anti ECM-1 (N-17), cat No sc-65086), 1:1000 to the cytoplasmic fraction.

Techniques: Expressing, Western Blot, Control

Journal: PloS one

Article Title: Human Melanoma cells over-express extracellular matrix 1 (ECM1) which is regulated by TFAP2C.

doi: 10.1371/journal.pone.0073953

Figure Lengend Snippet: Figure 4. 5’ RACE in the A375 cell line. Sequence upstream of the ECM1 start site showing a major (red) and minor (green) transcription start site (TSS), upstream of the start codon ATG. A TATA box is seen upstream of the major transcription start site. Boxes represent transcription factor binding sites (A). Dual Luciferase assay in A375: BFigure shows Relative Luciferase activity (run in triplicates, results shown as mean and SD) of fragments containing sequences upstream of the ECM1 TSS. There is a significant (*, p=0.0005) drop in luciferase activity when fragment G is further deleted (B). Site directed mutagenesis: Luciferase activity of Fragment H mutated (designated as M) at the Ets, AP-1 and Sp-1 sites is significantly lower than that observed for the WT construct * p < 0.05. The transfections were done in triplicate and the graph represents the mean value of the 6 values obtained for each plasmid (C).

Article Snippet: After blocking was accomplished with 5% milk Tris Buffer Saline Tween-20 solution, the primary antibody was added - TFAP2 (Abcam, Cambridge MA), to the nuclear fraction membrane at 1:15,000 dilution or ECM1 antibody (Santa Cruz Polyclonal anti ECM-1 (N-17), cat No sc-65086), 1:1000 to the cytoplasmic fraction.

Techniques: Sequencing, Binding Assay, Luciferase, Activity Assay, Mutagenesis, Construct, Transfection, Plasmid Preparation

Journal: PloS one

Article Title: Human Melanoma cells over-express extracellular matrix 1 (ECM1) which is regulated by TFAP2C.

doi: 10.1371/journal.pone.0073953

Figure Lengend Snippet: Figure 5. AP2C Chip-seq data from A375 cells. A global view of the 5’ region of ECM1 (A) and a more honed in view of the promoter region (B). A notable peak was identified centered at chromosomal location 148747123. Reads were aligned with Bow tie and bam files then coverage was determined using the BEDtools version 2.11. The bedgraph output was converted to bigwig and visualized in the UCSC genome browser. Mutating the putative TFAP2C binding site significantly reduced the promoter activity compared to the fragment containing the WT sequence (C). Alignment of the human and mouse promoter sequences showing the TFAP2C binding site and those of other transcription factors (D).

Article Snippet: After blocking was accomplished with 5% milk Tris Buffer Saline Tween-20 solution, the primary antibody was added - TFAP2 (Abcam, Cambridge MA), to the nuclear fraction membrane at 1:15,000 dilution or ECM1 antibody (Santa Cruz Polyclonal anti ECM-1 (N-17), cat No sc-65086), 1:1000 to the cytoplasmic fraction.

Techniques: ChIP-sequencing, Binding Assay, Activity Assay, Sequencing

Journal: PloS one

Article Title: Human Melanoma cells over-express extracellular matrix 1 (ECM1) which is regulated by TFAP2C.

doi: 10.1371/journal.pone.0073953

Figure Lengend Snippet: Figure 6. Gel-shift analysis of TFAP2C. The figure shows TFAP2C interactions with 32P-labeled promoter region of ECM1, consecutive cold competitors (F1-4) and Abs against TFAP2C used in super-shift performance. The sequences are as follows: F1 – ATCAGTCCCATTCTTCTCAATCCTCTGA;. F2- GGAGGCTTCAGGGTGACTTTGGGAGGAGTGGCTTCCAGA GGAGGAGCAGCTGGGAC;. F3 – TGAGTCATGGCAGGAAGCTGAGGAGGGC and. F4 - GGGAGATCACACCAGACAATTATAAAAG. In F2, the underlined sequence corresponds to the site identified by ChIP-seq and the bold sequence corresponds to the upstream site that partially competes in the assay.

Article Snippet: After blocking was accomplished with 5% milk Tris Buffer Saline Tween-20 solution, the primary antibody was added - TFAP2 (Abcam, Cambridge MA), to the nuclear fraction membrane at 1:15,000 dilution or ECM1 antibody (Santa Cruz Polyclonal anti ECM-1 (N-17), cat No sc-65086), 1:1000 to the cytoplasmic fraction.

Techniques: Gel Shift, Labeling, Sequencing, ChIP-sequencing

Journal: PloS one

Article Title: Human Melanoma cells over-express extracellular matrix 1 (ECM1) which is regulated by TFAP2C.

doi: 10.1371/journal.pone.0073953

Figure Lengend Snippet: Figure 7. ECM1 silenced cells, as evaluated by western blots, showed significantly reduced cell attachment (*p<0.01) for both A375 and M21 cell lines when compared to cells transfected with NT siRNA. Attachment was measured as described in the methods section.

Article Snippet: After blocking was accomplished with 5% milk Tris Buffer Saline Tween-20 solution, the primary antibody was added - TFAP2 (Abcam, Cambridge MA), to the nuclear fraction membrane at 1:15,000 dilution or ECM1 antibody (Santa Cruz Polyclonal anti ECM-1 (N-17), cat No sc-65086), 1:1000 to the cytoplasmic fraction.

Techniques: Western Blot, Cell Attachment Assay, Transfection